| My Online Sponsors To Date |
| DATE |
NAME |
AMOUNT |
COMMENT |
|
02/07/2010 |
TJ |
$70.00 |
http://www.thelifeyoucansave.com/ |
|
03/06/2010 |
Cash Donation |
$10.00 |
Can we get to $2000? |
|
01/06/2010 |
Catherine B |
$25.00 |
|
|
01/06/2010 |
Melissa Barry |
$10.00 |
Melissa Barry did not make the comment shown below. Does this mean you (Sarah) will shut up at home now? |
|
01/06/2010 |
Melissa Barry |
$13.00 |
Sarah is awesome |
|
31/05/2010 |
Cash Donations |
$246.00 |
Cash donations and bake sale proceeds. Thanks so much for your support everybody! |
|
30/05/2010 |
Dayz |
$50.00 |
Great Effort Well Done! |
|
29/05/2010 |
Kathleen |
$25.00 |
haha Meaghan I betcha this is the longest you've ever been quiet!! |
|
29/05/2010 |
Lisa McGonigle |
$10.00 |
Sarah is awesomely brilliant. Amazingly so. |
|
28/05/2010 |
Kirsty |
$25.00 |
Love the idea! And anyone who can keep Abi silent for that long deserves the $$$$$ :) |
|
28/05/2010 |
AJ |
$10.00 |
|
|
28/05/2010 |
Bianca Dobson |
$10.00 |
'Cause Sarah is awesome |
|
28/05/2010 |
Bianca Dobson |
$25.00 |
AUGGCUAAUTATGGTCGTGAAGCUACT
TGGATTAGTCATGAAAGTCTTGAAGAT
TTTCGTATGGTTATTGCUAAUTGTGCU
CCTAGTAGTGCUCGTGCUCATATTAGT
CATGAAGCUCCTAGTAAUGAAGCUACT
|
|
28/05/2010 |
Sarah Paterson |
$15.00 |
|
|
28/05/2010 |
Rachel |
$20.00 |
Great lab spirit! How is the lab productivity with all this silence? |
|
27/05/2010 |
McCartney's |
$25.00 |
Half way there- keep up the good work. |
|
27/05/2010 |
Abi |
$12.00 |
Donations towards baking effort ... I'm cash poor this week.
Man this is difficult! Try not talking when you get stung by a bee! Somehow it's do-able. |
|
27/05/2010 |
Sophia's Mum |
$25.00 |
This would be a first in 21 years - silence! |
|
27/05/2010 |
Neil Gemmell |
$25.00 |
Well done. Not sure I could do it.... |
|
27/05/2010 |
Elaine |
$10.00 |
The silence of the morning tea was pretty awesome. So was the chocolate cake, thanks Sarah. |
|
27/05/2010 |
Anonymous |
$50.00 |
Worthy cause, delightful effect. |
|
27/05/2010 |
Chu |
$25.00 |
|
|
27/05/2010 |
Roger |
$10.00 |
|
|
26/05/2010 |
Aleisha and Tessa |
$12.00 |
|
|
26/05/2010 |
David Raubenheimer |
$25.00 |
Nice work! |
|
26/05/2010 |
H. L. Price |
$11.00 |
|
|
26/05/2010 |
Cash Donations |
$60.00 |
|
|
26/05/2010 |
Various Merriman Lab members |
$40.00 |
Awesome work guys! |
|
26/05/2010 |
Teena |
$10.00 |
Wonder if we could convince other labs to do this. . .Silence of the Department? |
|
26/05/2010 |
R III |
$10.00 |
|
|
25/05/2010 |
Cancer Genetics Laboratory AGAIN |
$15.00 |
We want to give you more money to keep quiet |
|
24/05/2010 |
Damien and Lucas S |
$25.00 |
|
|
24/05/2010 |
Joe O'Neill |
$25.00 |
|
|
23/05/2010 |
Thomas Leask |
$20.00 |
Happy Birthday Megan! |
|
22/05/2010 |
Willy |
$5.00 |
my ticket to heaven |
|
21/05/2010 |
David |
$15.00 |
I intend to come visit and pronounce the eminent sensibleness of Sophophora melanogaster's new name and generally poke people with sticks. |
|
21/05/2010 |
Silent Bob |
$20.00 |
|
|
21/05/2010 |
Anonymous |
$37.00 |
Woop woop $1000!! Good work guys! Poppas to celebrate? |
|
20/05/2010 |
Catherine Collins |
$10.00 |
Good luck!! |
|
20/05/2010 |
Iain Lamont |
$10.00 |
|
|
20/05/2010 |
Rebecca Debono |
$20.00 |
Good luck guys...Glad Im just donating and dont actually have to do this, it sounds hard :) |
|
20/05/2010 |
Chris Kenny |
$10.00 |
|
|
20/05/2010 |
Tom McCowan |
$10.00 |
|
|
20/05/2010 |
Catherine |
$5.00 |
good cause, good luck. |
|
20/05/2010 |
Abhishek |
$8.00 |
Nxt time - Silence of Postgraduate Room :) |
|
20/05/2010 |
Darren Hart |
$25.00 |
Brains May explode ! |
|
20/05/2010 |
Anissa Fay |
$15.00 |
|
|
20/05/2010 |
Margi |
$25.00 |
|
|
19/05/2010 |
Kurt Krause |
$25.00 |
Best of luck with this idea! |
|
19/05/2010 |
Rosalind |
$25.00 |
|
|
19/05/2010 |
Judy Broom |
$25.00 |
Hah! You lot, slient? My money is safe... I will have to find another way to donate to UNICEF. |
|
19/05/2010 |
Lucy Dalton |
$25.00 |
Good luck!! |
|
18/05/2010 |
Ross Morgan |
$50.00 |
A muzzle would be cheaper... |
|
18/05/2010 |
Nana Morgan |
$25.00 |
Good luck from Whakatane. You'll need it. |
|
18/05/2010 |
David |
$25.00 |
Sounds like a "conspiracy of silence' |
|
18/05/2010 |
Michaela Corlet |
$5.00 |
:] |
|
17/05/2010 |
Helen |
$10.00 |
Are we allowed to come and say provocative things that you're not allowed to reply to?! |
|
17/05/2010 |
Poor OCD Student |
$6.00 |
I would give more but I can't ... but at least this makes the total a nice round number ... for now at least |
|
17/05/2010 |
Jools |
$20.00 |
17 years of knowing Abi...can't remember her being silent for more than very short periods of time...
Good luck with that one!! |
|
17/05/2010 |
Cash Donations |
$40.00 |
Donations from Sarah M's family, Meaghan O's family, and GENE 360 students. Thanks for your support everyone! |
|
17/05/2010 |
Rob Jones |
$39.00 |
Great work people! |
|
14/05/2010 |
Jarman |
$10.00 |
Good work guys! I tried this for a day when I was younger, and it is A LOT harder than you will be imagining now! |
|
14/05/2010 |
Margaret Sands |
$20.00 |
Way to go Megan L ... great cause and you are braver than me to tackle a challenge like this. Good Luck. |
|
14/05/2010 |
Gayle Leask |
$20.00 |
|
|
14/05/2010 |
Baby James |
$10.00 |
I believe in you.
(& I secretely think the Dearden lab - and genetics- is better.) |
|
14/05/2010 |
Ben Dover |
$10.00 |
|
|
13/05/2010 |
Kathryn McRae |
$20.00 |
Good luck, it's a great cause! |
|
13/05/2010 |
Elaine |
$25.00 |
May be tempted to double my donation if the "no speak" could be extended to home time too :-) |
|
13/05/2010 |
Alison Mercer |
$25.00 |
Brilliant! Good luck! |
|
13/05/2010 |
Lady Megal |
$20.00 |
This might just be the biggest challenge of my life. |
|
13/05/2010 |
Chris Dearden |
$50.00 |
It's never happened before - long may it continue! |
|
13/05/2010 |
Clive |
$25.00 |
Too good an opportunity to miss! |
|
13/05/2010 |
Sarah Morgan |
$10.00 |
I'm willing to pay my own lab to shut up year-round, how bout we do that next?! |
|
13/05/2010 |
Esther |
$25.00 |
Good luck! |
|
13/05/2010 |
Jenny Toomer |
$25.00 |
|
|
12/05/2010 |
Sumana |
$10.00 |
Awesome poster |
|
12/05/2010 |
Mel Havler |
$25.00 |
Good Luck!! |
|
12/05/2010 |
Craig Marshall |
$25.00 |
I'm deeply sceptical and wonder if actual physical harm might result from restraint of speech |
|
12/05/2010 |
Tania Cumming |
$10.00 |
|
|
12/05/2010 |
Sophia McKay |
$20.00 |
I'm right next door so will be able to keep a close eye - or ear as the case may be... |
|
12/05/2010 |
Bodhi |
$10.00 |
I'll believe it when I see it! |
|
12/05/2010 |
Baldy |
$10.00 |
i don't believe this will happen, but by betting on it i get to slap you all when it fails. See you at christmas! (if not before Peter...) |
|
12/05/2010 |
Cancer Genetics laboratory |
$25.00 |
If this is successful, perhaps it should be a regular event. |
|
12/05/2010 |
John Reynolds |
$25.00 |
Good luck guys - silence is Golden or in Peter's case, damn near impossible. |
|
11/05/2010 |
Jane |
$25.00 |
|
|
11/05/2010 |
Bob |
$25.00 |
|